MESSAGE
PeanutBase has transitioned to a new technology format. All updates are now at the new site still under development. Please visit the new site and give us your feedback. The legacy site is still available at legacy.peanutbase.org.
Late leaf spot (Phaeoisariopsis personata infection)
TO:0000439
Trait synonyms: Fungal disease resistance, LLS res, Late Leaf Spot resistance (Phaeoisariopsis personata)
The organism was previously known as Cercospora personata, Cercosporidium personatum and Mycosphaerella berkeleyi.
Late leaf spot (LLS) and rust are two major foliar diseases of peanut that often occur together leading to 50–70% yield loss in the crop. The symptoms of LLS are circular and darker spots appear on the lower surface of the leaves and also forms in stems and pegs resulting in severe yield loss to the groundnut growers. LLS also has an adverse influence on seed quality as well as on quality of haulms. The regular incidence of the above disease under late sown conditions warrants the development of resistant cultivars in groundnut. Though there are many chemical control methods available, development of disease resistant varieties is the best way to control the disease to improve production quality and reduce the adverse effects of chemicals on our ecosystem.
Image source:
http://www.peanut.ncsu.edu/Diseases/Early_and_Late_Leaf_Spot.aspx
| Marker | IPAHM103 |
|---|---|
| source | Khedikar, Gowda et al., 2010 |
| comments | "IPAHM 103 was strongly associated with resistance in the majority of cases (hybrid derivatives from NcAcs, interspeciWc derivatives, mutant lines) except in few (VR 5, MN 1-28, Girnar 1, ICGV 86590, ICGV 87921, ICGV 86156) germplasm lines. (Khedikar, Gowda et al., 2010) |
| type | SSR |
| Repeat | (CA)3(GA)17 |
| Forward primer | GCATTCACCACCATAGTCCA |
| Reverse primer | TCCTCTGACTTTCCTCCATCA |
| Size (bp) in susceptible lines | 160 |
| Size (bp) in resistant lines | ~140 |
Genotypes:
| Accession (ICRISAT) | Susceptibility | aAllele | Pedigree | plant type | Accession source |
| TAG 24 | Susceptible | A | |||
| R8808 | Susceptible | A | ICGS 11× Chico | Spanish bunch | ICRISAT |
| Dh 40 | Susceptible | A | Dh 3-30 × TGE 2 | Spanish bunch | ICRISAT |
| K 134 | Susceptible | A | Kadiri 3 × JL 24 | Spanish bunch | ICRISAT |
| TG 41 | Susceptible | A | TG 28 × TG 22 | Spanish bunch | ICRISAT |
| KRG 1 | Susceptible | A | Selection from Argentina | Spanish bunch | ICRISAT |
| TMV 2 | Susceptible | A | Mass selction “Gudhiatham Bunch” | Spanish bunch | ICRISAT |
| JL 24 | Susceptible | A | Selection from EC 94943 | Spanish bunch | ICRISAT |
| Dh 8 | Susceptible | A | Selection from RS 144 | Spanish bunch | ICRISAT |
| DH 43 | Susceptible | A | Mardur local | Virginia runner | ICRISAT |
| Chitra | Susceptible | A | Spanish 5B-1 × EC 1688 | Virginia runner | ICRISAT |
| R 9227 | Susceptible | A | (ICGS 7 × NC Ac 2214) × ICGV 86031 | Spanish bunch | NC Ac derived |
| ICGV 86031 | Susceptible | A | F 334 A-B-14 × NC Ac 2214 | Spanish bunch | NC Ac derived |
| R 9214 | Susceptible | A | (ICGS 7 × NC Ac 2214) × ICGV 86031 | Spanish bunch | NC Ac derived |
| ICGV 91180 | Susceptible | A | [(TMV 2 × FSB 7-2) × NC Ac 2232) × (F 334 A-B-14 × NC Ac 2214)] |
Virginia bunch | NC Ac derived |
| ICGV 99004 | Susceptible | A | TMV 2 × ( A. hypogaea × A. cardenasii) | Spanish bunch | interspecific |
| ICGV 99001 | Susceptible | A | Robut 33-1 × A. villosa | Virginia bunch | interspecific |
| GPBD 4 | Resistant | B | Spanish bunch | ||
| ICGV 93008 | Resistant | B | [(Mani Pintar × (Robut 33-1 × NC Ac 2232)] × ICG 2320 | Virginia bunch | NC Ac derived |
| ICGV 90266 | Resistant | B | [((J 11 × (M 13 × NC Ac 2214)) × ICG 2271] | Virginia bunch | NC Ac derived |
| R 8972 | Resistant | B | ICGS 59 × NC Ac 2240 | Spanish bunch | NC Ac derived |
| ICGV 87264 | Resistant | B | Manfredi × NC Ac 17133RF | Spanish bunch | NC Ac derived |
| Dh 73 | Resistant | B | Dh 3-30 × ICGV 87264 | Spanish bunch | NC Ac derived |
| ICGV 92188 | Resistant | B | [(Robut 33-1 × (M 13 × NC Ac 2214)] × JL 24 | Virginia bunch | NC Ac derived |
| ICGV 93023 | Resistant | B | [(Robut 33-1 × NC Ac 2214) × Cyto 213-2] | Virginia bunch | NC Ac derived |
| ICGV 87807 | Resistant | B | [(MK 374 × Robut 33-1) × FESR 2 | VL | NC Ac derived |
| ICGV 91177 | Resistant | B | (F 334 A-B-14 × NC Ac 2232) × ((TMV 7 × FSB 7-2) × NC Ac 2214) | Virginia bunch | NC Ac derived |
| D 39d (Purple & large) | Resistant | B | KRG 1 × CS 16 (ICGV 86855) | Spanish bunch | interspecific |
| D 39d (Purple & small) | Resistant | B | KRG 1 × CS 16 (ICGV 86855) | Spanish bunch | interspecific |
| B 37c | Resistant | B | JL 24 × ICGV 87165 | Spanish bunch | interspecific |
| A 30b | Resistant | B | KRG 1 × ICGV 87165 | Virginia bunch | interspecific |
| ICGV 88256 | Resistant | B | (CS 9 × (Robut 33-1 × NC Ac 316) | Virginia bunch | interspecific |
| MG 8 | Resistant | B | Mutant 45 × GBFDS 272 | Spanish bunch | interspecific |
| GBFDS 272 | Resistant | B | (A. hypogaea × A. caredenasii) | Virginia bunch | interspecific |
| JG Thin shell | Resistant | B | JL 24 × GBFDS 272 | Spanish bunch | interspecific |
| ICG 99005 | Resistant | B | TMV 2 × (A. hypogaea × A. batizocoi × A duranensis) | Virginia bunch | interspecific |
aAllele: A = allele present in TAG 24 genotype (susceptible to rust) and B= allele present in GPBD 4 genotype (resistant to rust)
NC Ac derived: derived from accession from North Carolina germplasm
| Marker | PM384 |
|---|---|
| source | Shoba, Manivannan et al., 2012 |
| comments | "While validating the three primers over a set of resistant and susceptible genotypes, the primer PM 384100 allele had association with resistance. Hence PM 384 could be utilized in the marker assisted breeding programme over a wide range of genetic background." (Shoba, Manivannan et al., 2012) |
| type | SSR |
| Repeat | |
| Forward primer | GGCGTGCCAATAGAGGTTTA |
| Reverse primer | TGAAAACCAACAAGTTTAGTCTCTCT |
| Size (bp) in susceptible lines | |
| Size (bp) in resistant lines | |
Genotypes:
| Genotypes | Accession (ICRISAT) | Susceptibility | aAllele | Pedigree | plant type | Accession source |
| COG 0437 | Resistant | A | Virginia bunch | ICRISAT | ||
| TMV 2 | Susceptible | A | mass selection from Gudiatham bunch (AH 32) and COG 0437 originated from the cross CO 2 × ICGV 94118 |
Spanish bunch | ICRISAT |
List of Late leaf spot QTLs at PeanutBase
Marker IPAHM103 at PeanutBase
